Python Developer

from Bio import SeqIO from Bio import SeqRecord from Bio import SeqFeature for rec in SeqIO.parse(&… Read more Storing The Output To A Fasta File

I have this very simple Python function, but there is one part I am confused about. The function is… Read more Why Does This Python Function Only Have One Output?

I'm trying to write a python script that will allow me to take the output from a command and to… Read more Redirect An Output Command To A Variable Or File?

I am using python 3. My code uses pdfminer to convert pdf to text. I want to get the output of thes… Read more Redirect Output Of A Function That Converts Pdf To Txt Files To A New Folder In Python

I'm using the MRJob module for python 2.7. I have created a class that inherits from MRJob, and… Read more Mrjob And Python - .csv File Output For Reducer?

I have the following list of dictionaries: [{'Sequence': 'TGACCCTGCTTGGCGATCCCGGCGTTTC&… Read more Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout

In Find all possible combinations that overlap by end and start, we get the following program that … Read more Modify For List Output In Recursion

Hi guys I'm farely new to python and I need your help. import sys, http.client file = open(… Read more Python Output Is Different Than What I Need